SELF/ICE MINTING
SUCCESFULLY MINTED!

You are now a TERRICOLA COLLECTOR of SELF/ICE Collection

The final image of your NFT will be updated soon

MANIFESTO TERRICOLA

keyboard_arrow_down

CONTENT

MANIFESTO TERRICOLA

../MANIFESTO_TERRICOLA/Concept

2023-24

It is an artistic document that presents a state of the current situation of humanity in different areas such as economics, ethics and morality, psychology, geopolitics, the environment and art, among others.

The project is developed in collaboration with the Institute for Future Technologies in Paris, France.

https://manifestoterricola.com

CONCEPT

It is an artistic document that presents a state of the current situation of humanity in different areas such as economics, ethics and morality, psychology, geopolitics, the environment and art, among others.

But the document also contemplates a particular materiality, being stored in DNA and encapsulated in biodegradable 3D ear produced for preservation on Svalbard Island in the Arctic and opens the possibility of having massive hard drives of digital information stored in DNA in the glacier ecosystems to preserve both with 0 environmental impact.

Formally, it follows two historical approaches to the meaning of an artistic manifesto, being at the same time a work and text of intentions and a scientific tool.


These intentions lie in an intrinsic analysis of materiality, the intangible, the anthropocene, science, digital storage and art itself, making formally, a tribute to these Terricola artists from Van Gogh to Stelarc to Joe Davis and introducing a new Ear in the Art History.

The text has been published, heard and introduced inside a glacier in Svalbard on 23 April 2023 in the Lat N: 78º15.359` and Long E: 016º14.165`

 

 

Play Video

BIO DIGITAL AND PHYSICAL ECOSYSTEM

The project also pretends to expand the notion of an artwork and to build a community around this social proposal.

For doing that, the Manifesto Terricola includes different formats like a music album, an immersive installation, physical artworks and a documentary.

MANIFESTO TERRICOLA TEXT 

chr0.MANIFESTO TERRICOLA (T)
Soliman Lopez, 48.84750823732765, 2.4402623979362046
13/03/23
DNA-coded by Javier Forment

chr1.INTRO
We assume hyper-digitalization, the Anthropocene, and the automation of tasks
We accept the artificial intelligence entities and the arrival of humanoids and extraterrestrials (maybe ourselves)

chr2.INTRO
We admit the possibility of eternal life
We welcome the “virreality” proposed by the connection of biotechnology and technological reality layers

chr3.INTRO
We want to feed a global “intelectosphere” and to balance the Hertzian frequencies in between our brains and the Earth
We need to do T art as a meeting point of knowledge for an existent future

chr4.TRANS
We are in a period of transition from the biological separation of human needs as species and the biotechnological alteration of bodies
We accept the importance of nature as a crucial form of pure knowledge

chr5.TRANS
We agree with the possibility of abandoning this planet physically and metaphorically
We apply intellect to understand the process to raise a human-machine-earth consciousness
Decorative art is not in the transition to being a T artist

chr6.TRANS
Art must be trans-species, transhuman and transcriptive to be in balance with Earth frequencies and our universal neighbors
T art has to assume the condition of hybridization, from sexual, racial, or cultural aspects to biological, intellectual, and sensory

chr7.SCI/FAITH1
Science, thanks to its great ally, technology, emerges victorious in front of faith
We promote updated and emancipatory iconographies of the collective imaginary and the factual powers
We need to live a scientific truth rather than an ideological metaphor

chr8.SCI/FAITH2
T art helps us to understand the complexity of the macro scales through the understanding of the micro ones
We create art that celebrates and promotes evidence-based research, reason, and human curiosity, rather than unfounded dogmas and beliefs

chr9.SCI/FAITH3
We believe in an art moving away from egocentrism to avoid individual histories in a world of fake news
We connect collective intelligence to artificial one to avoid stupid intelligence
A T creates his own collective decentralized deities thanks to pure knowledge and logic

chr10.ECOS1
The first eco-nomies are those obtained from natural systems, or what we call agriculture
A T artist doesn’t believe in the ecos created for self-interest purposes
We believe the true power lies in understanding the environment (physical, digital, or hybrid)

chr11.ECOS2
We deny the connection between eco-logy and eco-nomy
T art responds to the conceptual interstices that stem from the confluence of economics, ecology, social ecosystems, eco-feminism, eco-anxiety, and eco-dependency

chr12.ECOS3
To be in harmony with the ecos is to be in frequency with the Earth
T art must be accepted as an eco in and of itself, bringing together all the available ecos- in our intellectual construction
T art is not affected by the centralized corporative eco-nomies

chr13.HUMANS1
We no longer inhabit the promised land, but we promise ourselves a better land
We have to be in the current intellectual climate to be T artists
A T artist vibrates in resonance with its Earth and the other ones to come

chr14.HUMANS2
Art provokes a global hyperconnection, a previsualization of the invisible, and a re-signification of the human, its challenges, questions, and answers
T art activates a new layer of thought in us since the machine takes care of the rest, to improve our consciousness

chr15.HUMANS3
As T and conceptual artists, we use technology, biology, astronomy, and any other sciences as the basic pigment for the construction of a new model of humanity
As T artists hear the frequencies of our environment to be compromised with the current human challenges

MANIFESTO TERRICOLA DNA-CODED SEQUENCE 

GATGGAAGGATCGACGGAGCGAGGGGATGGGAGATTACAAGGGAGAGGGGACGGACGACGGAATGATTGATAGAAGAACCGGATGCTTGCTAGCCGGCTGGCAGGCTCACAAGATAGCTTGTAAGCGGGTCCACTAACAAATGAATCAACTCATCAATGAATGTATGGATAAATCAATACATATATGTATATATACATGTATGCATGGACTAACAAATACACTCATGAATGAATAAATACATGCATACATATATCGATGTATCGATATATGCATACATAAATGAATGCACAAAACCATAGATATACTTATAAATATACTTATACATATAACCGAGAGATCGAAGACTGGCATGCTTGCGAGCGGGCGAACAAGCACGTCGACAAGACCGCAGGTGCGCCGGCGGGTACACAAGAGCGCTTGTACGCTGGCGGGCTCGTGAAACCAACCGACGGATCGGGAGGACGATTAACCGGGTGCGGACAAGCAGGTATGTATGTGGGCTGGCGGACAAGCCAGTCGGTAAGCGGGTACACTGGCGAGCCGGCGTGCCGGTGAGCAGGCTAGCCGGTCCGCAGGTGAGCCGGCTTGCTCACTAACAAGTGAGCCAGCGGACAAGAAGGCTCGTGAGCCAGTACGCTTGTAAGCTTGCATGCGGGCTCGCGGACTAACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCAGGTGGGTGAGCTTGCTGGCAGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGTGAGCAGGTATGCCTGTATAACCGGGTGCGGACAAGCAGGCATGCATGCGGGTAAGTGAACAAGTGAGCCAGCGGACAAGCAGGTACGTGAGCCGGCGCGCCGGCATGCCGGCAGGCTAACAAGCCGGCTCGTGAGCGGGCTAGCTAGCCGGCGTGCGGGCTCGCATGCGGACAAGCGGGCTCGTGAGCCGGTGAGCCGGCGGGTATACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCAGGTACGTACGCCGGTGCGCAGGCTAACAAGCTTGCGCACAAGCCAGTGGGCTGGCAGGCTCGCTTGCCGGCGAGTATACAAGCAGGCTCGCGAACAAGCGGGTCAGTGAGTACGCAGGTGAGCGGGTACGTACGCGGGTATGTGAGTACGCCGGCAGGCTAGTATACAAACCAGCTGGCAGGTCGGCACGCGGACAAGCTTGTGGGTACGTATGCGGGCTAGTGCGCGGGTATACCGAACCGGGTGCGGACAAGCAGGCGAGCTGGCCGGTGAACAAGTGAGCCAGCGGACAAGTAAGCTTGTATGTATGCCGGCACGCCGGCTAGCCGGTGAGTCGACAAGCTTGCGCACAAGCGGGTGAGCGGGTACGCTCGCAGGCTAACAAGCTAGCCGGCGCGCGGAACCGGGTGCGGACAAGTGTGCGGGCTAGCATGCTTGCTGGCGGACAAGTGAGCCAGCGGACAATCACCAAACGTAGTGCGCCGGTACGTACGCGGGCAGGCTAGCCGGTGAGTCGTCACCAAACGTGACAAGTAAGTACGCTTGTAAGCTTGTATGCGGGCGAACAAGCACGTCGACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGCTCGCGGGCATGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGCACGCCGGCTTGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGTCGACAAGCAGGCTCGCGAACAAGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGCCGGCATGCAGGCTAACAAGTACGCGGGCAGGCTAGCCGGTGAGTCGACAAGCTAGCAGGTCGGCGGGTACGTATAACCGGGTGCGGACAAGTGTGCAGGCTCGTGAACAAGTGAGCTTACAAGCGCGCGGGCGGGCGAACAAGCAGACAAGCGTGCTAGCTTGCACGCAGGCTAACAATCACCAAACGTAGCCGGCTCGTGAGCGGGCTAGCGGGCATGTGAGCTTGTATGTAAGCCAGCGGGTACGCGGTCACCAAACGTGACAAGCAGGCTCGCGAACAAGTGAGCTTACAAGCACGCAGGCTAGCAGGCTCGCATGCGGACAAGTGAGCCAGCGGACAAGACAGCGGGTACGTGAGTCCGCCGGCAGGCTCACAAGCGCGTACGCGGGTAGGTGGGCGGGCTCGCATGCCGGCGGGTATACAAGCCGGCTCACAAGCACGCGGGTGAGTGTGCGGGCGGGCTCACAAGCTTGTGGGTACACAAGCACGTACGCAGGCCGGCTCGTATACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGAGGGCAGGTACGTGAGCCAAACCGGGTGCGGACAAGCTCGCGGGCGGGCGAACAAGTGAGCTTACAAGCGAGCTTACAATCACCAAACGTAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGTCACCAAACGTGACAAGCAGGTACGTGAACAAGCAGGTATACAAGCAGACAAGCTGGCGGGCGGGTGAGCCGGCTCGCGTACAAGTAAGCTTGCCGGCTCGTGAACAAGCTTGCGCACAAGCCTGCTCGCTTGTGTGCTAGCGGGCGAGCGTGCGGACAAGCGCGCTTGTACACAAGCAGGCTCACAAGCGGGTCAGCCGGTATGTGAGCGGGCTCGTGAACAAGCGCGTGGGTGAGTGGGTACGCGGAACCAACCGGGAGGACGAAGGATCGGATAACCGGGTGCGGACAAGCAGGTACGCGGACAAGCCGGCTCACAAGCAGACAAGTAAGCGGGTACGCCGGCTTGCGAACAAGCTTGCGCACAAGTGAGTACGCAGGCTCGTATGCCGGTGAGCCGGCTTGCTCACAAGCGCGTACGCTTGCTGACAAGTGAGCCAGCGGACAAGCACGCCGGCTTGCTAGCTTGCGTGCCGGCATGCAGGCTAACAAGTATGCGGGTAAGCAGGTACGCAGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGCCAGTGGGCTGGCAGGCTCACAAGCTCGCGGGCGGGCGAGTATACAAGCAGGTATACAAGTATGTAAGCGGGCATGCCGGCGGGTATACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCACGCCGGCTTGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGCCGGCATGCAGGCTAACAAGCAGGCTAGTGAGCGGGTACGCAGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGCACGCTTGCGAGCCGGCGGGTATAACCGGGTGCGGACAAGCAGGCATGCATGCGGGTAAGTGAACAAGTGAGCCAGCGGACAAGCCGGCTGGTAAGCTTGTACGTGAGCAGGCTCGCATGCGGACAAGCTTGCGCACAAGCTCGCAGGTGAGTGGGTACGCGGACAAGCAGGTATACAAGCAGACAAGCATGTACGTGGGCATGCCGGCAGGCTAACAAGCGCGCTTGTACGCTGACAAGCTTGCGCACAAGTAAGTGGGTACGCGGACAAGCCTGCTCGCTTGTGTGCTAGCGGGCGAGCGTGCGGAACCGGGTGCGGACAAGCAGGCGTGTACGCGGGCGGACAAGTGTGCCGGTGAGCCAACAAGTGAGCCAGCGGACAAGTAAGCTTGTATGTATGCCGGCACGCCGGCTAGCCGGTGAGTCGACAAGCTTGCGCACAAGCAGGCACGCAGGCTCGCGAGCTTGCTCGCCGGCTCGCGTACAAGTGAGCCAGCCGGTATACAAGTAAGCTAGCAGGCTCGCGGGTGAACAAGTAAGCCAGTCGGTATGCCGGCATGCAGGCTAGCTAGTCGACAAGCAGGCTCGCGAACAAGCTGGCGGGTGAGCAGGTAAGCCAGCTTGTACGCCGGCATGCAGGCTAGCTAGTCGAACCGGGTGCGGACAAGCAGGTAAGTAAGCTAGTCGACAAGCCGGCTCGTGAGCGGGCTAGCTAGCGGGCATGTGAACAAGTGAGCTTACAAGTGGGCTCGCGAGCGGGTACGTATGTGAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGTAAGTACGCTTGCATGCGGGTATGTATACAAGTGAGCTTACAAGTACGCAGGCCGGTATGCGGACAAGCAGACAAGCCAGTGGGCTGGCAGGCTCACTGGCTGGCAGGCATGCCAGCCGGCTCGCGGACTGGCGGGCAGGTACGTGAGCCAACAAGCATGCTTGCTCGTATGCATGCCGGCTTGTGGGTATGCTCGCGGGTATGTATAACCGAGAGCGGGCATGCTTGTACGCAGGTGAGCCGGTGCGCGGACAAGCAGGTACGTGAACAAGCCGGTATACAAGCTCGCTTGTGAACAAGCCGGCTCACAAGTGAGCCAGCGGACAAGTGAGTACGCAGGCTCGTATGCCGGTGAGCCGGCTTGCTCACAAGTGAGCTTACAAGCACGCGGACAAGCAGACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAGCCGGTATGTGAAACCGAAGGTACGTGAACAAGCTGGTGGGTATGTGAACAAGCACGCGGACAAGTGAGTACGCAGGCTCGTATACTGGTATGTAAGCGGGCATGCCGGCGGGTATACTAACAAGTGAGTACGCAGGCTCGTATGCCAGTGGGCTGGCAGGCTCACAAGCAGGCTCGCGAACAAGTGAGTACGCAGGCTCGTATGCATGTACGCCGGTAAGTGAGCCGGTGCGCGGACAAGTGAGCTTACAAGCACGCGGACAAGCCGGCTCACAAGCACGCAGGCTAGCAGGCTCGCATGCGGACAAGTGTGCCGGTGAGCCAACAAGAGGGCAGGTACGTGAGCCAACAAGCGCGTACGCGGGTAGGTGGGCGGGCTCGCATGCCGGCGGGTATACAAGCAGGCTCGCGAACAAGCTTGTGGGTACACAAGTGGGCTCGCCGGTGCGCGGGTACGTATGCAGGCTAACAAGCTCGCGGGCCGGCGTGCCAGCACGCTTGTACGTATAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGCCAGCAGGTATACAAGTGAGCTTACAAGCAGGTATGTATGTGGGCTGGCGGACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGCGAGCCGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGCCAGTCGGCACGTACGCCGGCGAGCCGGTCCGCAGGTGAGCCGGCTTGCTCACTAACAAGCGCGTACGCTTGCTGACAAGTATGCGGGTCAGTGGGCAGGCTAACTAACAAGTACGCAGGCATGCCGGCAGGCTAACTAACAAGCTTGTACACAAGCATGTGGGCTAGTGAGTGGGTACGCAGGCTAACAAGCAGGTATGTAAGCGGGCATGTGAGTATACAAGTGAGCTTACAAGCACGCCGGCTTGCTAGCTTGCGTGCCGGCATGCAGGCTAACTAACAAGCCGGCTCGTGAGCGGGCTAGCTAGCGGGCATGTGAGTGGGCAGGCTAACTAACAAGCAGGCTCGCGAACAAGTATGCGGGCTCGTATGCTTGTACGTCGAACCAACCGGATGAATGACGGAGGGATCGAATGAGGACTTGAGCGAAGGACGGGGAGACAAACCGGATGCATGCCGGCGGGCTCGCATGCGGACTAACAAGTGAGCCAGCAGGCTCGCCTGTATACAAGTGAGCTTACAAGCCGGTGAGTATACAAGCGTGTACGCGGGCAGGTGAACAAGCAGGCTAGCTAGTCGACTAACAAGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGTCGACTAACAAGCGGGCTGGCGGGTACGCGTGCGGGTATACAAGTGCGCCGGCATGTGAGCTTGTACGCCGGCTTGTGGGTATACAAGCCGGCTCACAAGCGCGTACGCTTGCTCGTGAACAAGCTTGCGCACAAGCGCGCAGGCCGGTGAGCCAAACCGGGTGCGGACAAGTAAGTACGCTTGCTGGCTTGTGAGCGGACAAGTGGGTAAGCGAGCAGGTGAGCGGGCGAACAAGCAGGCTCGCGAACAAGCGGGCTGGCAGGCTCGCATGCCGGTAAGCAGGTGAGCTTGTACGTCGACAAGCCGGCATGCTTGCTCGCTTGCGTGTACGCAGGTAAGCCAGCCGGCGGGTATACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGCATGCTTGCTAGCTAGCGGGCATGTGAGCCGGTGCGCGGACAAGCCGGCTGGCAGGCGTGCCGGCTCGCAGGTACGTCGACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCGCGCAGGCATGTGAGTGGGCAGGCTAACAAGTAAGCTTGTGTGCGGGTACGTATAACCGGGTGCGGACAAGCTCGCGGGCGGGCGAACAAGTGAGCTTACAAGCTAGCCGGTGCGCGGACAAGCAGACAAGTATGCATGCCGGCGGGCTCGTGAGCCGGCGCGCCGGCATACAAGTGAGTACGTGGGTGAGCCAACAAGTACGCAGGTGAGCCAGCGGGTACACAAGTGAGCCAGCAGGCTCACAAGCAGGCTCACAAGCCGGCGAGCGGGCTTGCTAGCTTGCGTGCCGGCATGCAGGCTAACAAGCTGGCGGGTGAGCAGGTAAGCCAGCTTGTACAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGCCAGCGGGCTAGTAAGTATACAAGTGGGTATACAAGTGAGCTTACAAGTGGGCTCGCGAGCGGGTACGTATGTGAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCATGCTTGCTGGTAAGCTAGCGGGTCAGCCGGTGAGTCGACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGCTGGCAGGCATGTACGCTTACAAGTATGCATGCAGGCTAGCGGGTATACAAGTGAGCCAGTACGCTTGTGGGCGTGCCAACAAGTGAGCCAGCGGACAAGTGGGCTCGCGAGCGGGTACGTATGTGAGCAGGCTCGCGAGCCGGCTCGCGTACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGCTGGCCGGCATGTACGCTTACAAGCTTGCTCGCGGGTATAACCGGGTGCGGACAAGCATGTACGCGGGCAGGTGAGCGGACAAGCAGGTACGTGAACAAGTGAGCCAGCAGGTGAACAAGCATGCGGGCTAGCGGGCACGTACGCAGGTGAGCGGGTATACAAGCAGGCTCGCGAACAAGTAAGTACGCTTGCTGGCTTGTGAGCGGGTATACAAGCGGGTGCGCCGGCGAGCGGGCTCGCATGCGGACTGGCACGCAGGTATGCGGGCGAACAAGTACGCGGGTATGCGGGCAGGTACGCATGCCAACTAACAAGTACGCGGGCAGGTATGCTTGCTCACTAACAAGCAGGCTCGCGAACAAGCCAGTGGGCTGGCAGGCTCACAAGCATGTGGGTACGCCGGCTTGTATGCCGGTGAGTCGACTAACAAGTACGCAGGTGAGCCAGCGGGTACACAAGTGAGCCAGCAGGCTCACAAGTGGGCTCGCGCGCTTGTGGGCTCGCGAGCGGGCGAACAAGCGAGCTTGCGTGCTGGCAGGTATACAAGCAGGCTCGCGAACAAGCACGCGGGCTAGCCGGCGGGCGCGTATAACCGGGTGCGGACAAGCACGCGGGCTAGCCGGCGGGTGCGCGGACAAGCCGGCTCACAAGCAGGCTCACAAGCAGGTACGTGAACAAGCACGCAGGTATGCGGGCGAACAAGCTTGCTCACAAGCAGGCTCACAAGCGGGCATGCATGCGGGCTCGTGAGTACGCCGGCATACAAGCTGGCTTGTGCGCGGGCTGGCGGGCTCGTGAACAAGCAGGTGTGCAGGTCGACAAGCGCGTACGCTTGCTGACAAGCGGGCGTGCTTGCATGCGGGCTCGTGAGTACGCCGGTATGCTGACAAGTGAGCTTACAAGCAGGTGCGCTTGCCGGCGAACAAGCCGGCTCGCGAGCCGGTGCGCCGGCGAGTGGGCAGGCTAACAAGCCAGCCGGTATGTGAGCTTGTACGCCGGCGGGTATACAAGCCGGCTCACAAGCAGACAAGTGTGCTTGTACGCTAGCGAACAAGCTTGCGCACAAGCGCGCAGGCCTGCGGACAAGCTCGCGGGTGTGTATAACCGGGTGCGGACAAGTAAGTACGCTTGTGCGCCGGCGAGCGGACAAGCATGCTTGCTAGCTAGCGGGCATGTGAGCCGGTGCGCGGACAAGCCGGCTCGTGAGCGGGCTAGCTAGCCGGCGTGCGGGCTCGCATGCGGACAAGTGAGCTTACAAGCATGCTTGCTCGCTCGCGGGCATGTGAACAAGTGTGCCGGTGAGCCAACAAGCAGGTACGTGAGCCGGCGCGCCGGCATGCCGGCAGGCTAACAAGCTTGCTCGCGGGTATACAAGTGAGCTTACAAGCAGGTGCGCTTGCCGGCGAACAAGTATGTGAGTGGGTAAGCCGGCGAACAAGCCGGCTCGTGAGCGGGCTAGCTAGCCGGCGTGCGGGCTCGCATGCGGAACCGAAGACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCATGTACGCGGGCAGGTGAGCGGGTATACAAGCCAGCCGGTATACAAGCTTGTGTGCTCACAAGCATGCTTGCTAGCTAGCGGGCATGTGAGCCGGTGCGCGGACAAGCGAGCGGGCATGCGGGCTCGTGAGTACGCAGGCTAGCCGGTCCGCGGGCGAACAAGCGAGCGGGCCGGTGAGCCGGCGGGTATACAAGTGAGCCAGCAGGCTCGCCTGTATACAAGTGAGCTTACAAGTAAGTGGGTACGCGGACAAGCCTGCTCGCTTGTGTGCTAGCGGGCGAGCGTGCGGACAAGCAGGCTCGCGAACAAGCTAGCTTGCGTGCCGGCATAACCACAAAACCGAGGGAATGATTGGATAACCGGGAGCCAGCGGACAAGCGCGCCGGTACGTATGTGAACAAGCGGGCATGCTTACTGGCTCGCTTGCTGGCCGGCGGGTATACAAGCAGGTACGCGGACAAGTGAGCCAGCTTGTATGCGGACAAGCTTGCACGTGAGCAGGCCGGCTCGCGGGCGAACAAGCGCGTACGCTTGCTGACAAGCTCGCAGGTGAGTGGGTACGCAGGCTAACAAGTATGTCGGTATGTGAGCGGGCTGGTATACTAACAAGCTTGTACACAAGTGTGCCAGCAGGTGAACAAGTGTGCGGACAAGCATGCAGGCTAGCTAACAAGCAGGCGTGTACGCCGGCATGTGGGCTAGTGAGTGGGTACGCGGACAAAACCGAAGACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAGCCGGTATGTGAACAAGCGAGCTTGCGGGTATGCTCTCACCAAACGCGGTGAACAAGCACGCGGGCTAGCCGGCGGGTGCGCGGACAAGCCGGCTCACAAGTGAGCCAGCGGACAAGCGGGCATGCTTGTATACAAGCATGTACGCGGGCAGGTGAGCGGGCGAACAAGCGCGCTTGTACACAAGTATGCGGGCTAGCGCACTGGCCGGCTCGTGAGCGGGTACGCGGGTATGTGAACAAGTAAGTGGGTACGTAAGCTTGTATGCGGGTATAACCGGGTGCGGACAAGCACGCGGGCTAGCCGGCGGGTGCGCGGACAAGTGAGCCAGCGGACAAGTGAGTACGTGGGCGGACAAGTAAGCTTGTGTGCGGGTACACAAGCTAGCCGGCGGGTATACAAGCCGGCTCACAAGTGGGCTCGCGAGCGGGTACGTATGTGAGCAGGCTCGCGAGCCGGCTCGCGTACAAGTGAGCCAGCGGACAAGCGGGCTCGTGCGCCGGTACGCTTGCTCGCTGGCGGGCTCGTGAACAAACCAGTAAGCCAGTCGGTATGCCGGCATGCAGGCTAACTAACAAGCGAGCCGGCGTGCCGGTGAGCAGGCTAACTAACAAGCTTGTACACAAGCCAGTCGGCACGTACGCCGGCGAACCGAACCGGGTGCGGACAAGCGAGCGGGCTCGTCGACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGCTCGCGGGCATGTGAGCCGGCTTGCTCACAAGCACGCGGGTGAGTGTGCGGGCGGGCTCACAAGCGGGCATGCTTACTGGCTAGCTTGCGTGTCGACAAGCAGGCTCGCGAACAAGCGGGCATGCTTACTGGCTCGCTTGCTGGTCGAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGTACGCGGGTATGTAAGCTTGCTCGCGAGTATACAAGTGAGCTTACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGCATGCGGGTAAGTGAGTGGGCAGGCTAACAAGCCGGCTCGTGAGCGGGTACGTATGTGAGCCGGCATGCGGGTATACAAGTGAGCCAGCAGGTGAACAAGTATGTGAGCGGGCTGACAAGCGCGTACGCTTGCTGACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGCGCGCTAGTGGGCGGGCTCGCATGCGGACAAGCTTGCGCACAAGCGGGCATGCTTGCTCGCTTGCTGGCCGGCATGTATACTAACAAGCGGGCATGCTTGCTAGCTTGCGTGTCGACTAACAAGTATGCTTGCATGCCGGCAGGCTAACAAGCGGGCATGCTTGTATGTCGGTATGTGAGCGGGCTGGTATACTAACAAGCGGGCATGCTTACTGGCGCGCGGGCTGGCCGGCTCGCCGGTATGCTGACTAACAAGCGGGCATGCTTACTGGCAGGCTCGTCAGCCGGCGGGTGAGTCGACTAACAAGCAGGCTCGCGAACAAGCGGGCATGCTTACTGGCGAGCGGGTAAGCGGGCTCGCGAGCGGGCTCGCATGTCGAACCGGGAGCTTACAAGCACGCGGACAAGCCGGCTCACAAGCCAGCAGGTACGCTGGCTTGCTCGTCGACAAGTGTGCCGGTGAGCCAACAAGTGAGCCAGCGGACAAGCGGGCATGCTTGTATACAAGCCGGTATACAAGTGAGCTTACAAGCACGCGGACAAGCCGGCTCACAAGCGCGTACGCGGGTAGGTGGGCGGGCTCGCATGTCGACAAGTGTGCCGGTGAGCCAACAAGTGAGCCAGCGGACAAGAGGGCAGGTACGTGAGCCAAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGCTGGTGGGTATGTGAACAAGCACGCGGACAAGCAGGCATGCATGCGGGTAAGTGAGCGGGCGAACAAGCAGGTATACAAGCAGGCTCACAAGCGGGCATGCTTACAAGCCGGCTCACAAGCAGGCTCGCGAACAAGCTTGCGCACAAGCCGGTGAGTATGCGGGCTAGCGCACTAACAAGCACGTACGCCGGCTCGCGTGCCGGCTCGCGTACAAGTGAGCTTGCGTGCGGGTGAGCCAGCGGGTACACAAGCAGGCTAGCTAACAAGTGAGCCAGCGGACAAGCAGGTGCGCAGGCCGGCTAGCAGGCACGCTAGCGGACAAGCGGGCATGCTTGTATACTGACAAGCCGGCTCACAAGCTTGTGGGTACACAAGCCGGCTCGTGAGCGGGCTAGCTAGCGGGCATGTGAGTGGGCAGGCTAACAAGCATGCTTGCTCGTATGTGAGTACGTGGGCATGTGAGCCGGCTTGCTCAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGCCGGTATACAAGCTCGCTTGTGAACAAGCAGGCGCGCGCGCGGGCATGTGAGCGGGCGAACAAGCACGTCGACAAGTGAGCCAGCGGACAAGCATGCGGGCTCGTGAGTACGCAGGCTAGCCGGTCCGCGGGCGAACAAGCATGCTTGTACGTAAGCTTGTACGCAGGTGAGCCGGTGCGCGGACAAGCGGGCATGCTTACTGGCTCGCTTGCTGGCCGGCGGGTATAACCAACCGACAGGGGGATGGAAGGATCGGATAACCGGGTGCGGACAAGCTCGCTTACAAGCTAGCTTGCTCGCGTGCGGGTACACAAGCCGGCTCGCCAGCAGGCACGCCGGTGAACAAGTGAGCCAGCGGACAAGTAAGTACGCTTGCTGGCCGGTATGCGGGCGAACAAGCTAGCAGGCTCGCGAACTAACAAGCACGTGGGTGAACAAGTGTGCGGACAAGTAAGTACGCTTGCTGGCCGGTATGCGGACAAGCTTGTGGGTACGTATGCGGGCTAGTGCGCGGGTATACAAGCAGACAAGCACGCGGGTGAGTGAGCGGGTACACAAGCTAGCAGGCTCGCGAACTCACAAGGGTGCGGACAAGCTCGCTTACAAGCTAGCTTGCTCGCGTGCGGGTACACAAGCATGCAGGTACGCGGACAAGTGTGCCAGCGGGTGAGCCAGCGGGTACACAAGCCGGTGAACAAGCCGGTATACAAGCTTGCTCACAAGTGAGCCAGCCGGTATACAAGTAAGCTAGCAGGCTCGCGGGTGAACAAGCTTGTACACAAGCAGGCTCGCTTGTGAGCCAGCGGGTACAACCGGGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTGAGCTTACAAGCACGCGGACAAGCCGGCTCACAAGTGAGCCAGCGGACAAGCATGTGGGTACGTACGCGGGCTCGTGAACAAGCCGGCTCGTGAGCGGGCTAGCTAGCGGGCATGTGAGTGGGCAGGCTAACAAGCATGCTAGCCGGCTGGCAGGTGAGCGGACAAGTGAGCTTACAAGCACGCGGACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAGCCGGTATGTGAGTATAACCGAAGACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAGCCGGTATGTGAACAAGTGCGCCGGCACGTACGCAGGTGAGCGGGTATACAAGCCGGCTCACAAGTACGCGGGTATGCTTGCTCGCAGGCTCGCATGCGGACAAGTGTGCCGGTGAGCCAACAAGCCGGTGAGTATACAAGAGGGCAGGTACGTGAGCCAACAAGCAGGCTCGCGAACAAGTGAGCCAGCGGACAAGCTTGTGAGCCAGCGGGTACACAAGCTTGCTCGCGGGTATACAAGTGAGCTTACAAGCATGCTTGCTGGCGGAACCGAAGGTACGTGAACAAGTAAGTACGCTTGTGCGCTTGCCTGCGGGTATACAAGCAGACAAGCGTGCTAGCTTGCACGCAGGCTAACAAGCCAGTCGGTAAGCGGGTACGCATGCTTGCTCGCTCGCGGGCATGTGAGCCGGCTTGCTCACTAACAAGCAGACAAGTAAGTACGCGGGTGCGCCGGTATGTGGGCAGGCTAGCCGGTCCGCAGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGCCGGCTCGTGCGCCGGTATGCCGGCACGCTAGCGGACTAACAAGCAGGCTCGCGAACAAGCAGACAAGTACGCGGACTGGTATGCCGGCGTGCTCGCCGGCGCGCCGGCATGCAGGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGCCAGTGGGCTGGCAGGCTCACTAACAAGCCGGTGAGTATACAAGCATGCCAGCAGGCTAGCTAGCGGGCTCGCGTGCGGGTATACTAACAAGTAGGTGGGCGGGTATGTGAGCCGGCTTGCTCGTATACTAACAAGCAGGCTCGCGAACAAGCAGGCTCGTATGTGTGCGGGTACGTATAACCGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAACAAGCAGGCATGTGAGCCGGTGCGCAGGTGAGCGGGTATACAAGCAGACAAGCTCGCGGGTGTACAAGCTAGCAGGTCGGCGGGTACACAAGCTTGCGCACAAGTGAGCCAGCTTGTGGGCGTGCCAGTGAACAAGCCGGCTCACAAGCTTGTGGGTACACAAGCGTGTACGCAGGTCGACAAGCTGGCAGGTGAGTGAGCGGGTACACAAGTATGCCGGCTCGCATGCGGACAAGTGAGCCAGCGGACAAGCTGGCAGGCATGCCAGCCGGCTCGCGGACAAGTGAGCAGGCCTGCGGGTATACAAGCATGCAGGTACGCGGACAAGCTTGCGCACAAGTGAGCCAGCGGACAAGTACGCGGGTATGTGAAACCGGGTGCGGACAAGCAGGTATACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGCTCGCGAACAAGCATGCTTGCTCGCATGCGGGTAAGTGAGTGGGCAGGCTAACAAGCAGGTACGTGAGCCGGTATGTGAGTATACTAACAAGTGGGTATGCGGACAAGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGTCGACTAACAAGTATGCATGCCGGCGGGCTCGCATGCGGACTAACAAGCACGCCGGCTTGCTAGCTTGCGTGTCGACTAACAAGCAGGTATGTGAGTACGCTTGCTCGCTTGCTGGTCGACTAACAAGCAGGCTCGCGAACAAGCAGGCTCGTCGACAAGCTTGTGAGCCAGCGGGTACACAAGCAGGTGCGCAGGCCGGCTAGCAGGCACGCTAGCGGACAAACACGCTAGCTTGCGTGTCGACACACAAGCAGGTATACAAGTGAGCCAGCGGACAAGCACGCAGGTATGCCGGCATACAAGTAAGCCGGCGTGCTGGCGGGCTCGTGAACAAGCGCGCTTGTACACAAGTGAGCCAGCGGACAAGCATGCTTGCTCGTATGTGAGTACGTGGGCATGTGAGCCGGCTTGCTCACAAGCTTGCGCACAAGCAGACAAGCTCGCGGGTGTACAAGCTGGCTTGCGAGCGGGCTAACAAGCTTGCGCACAAGCCAGTGGGCTGGCAGGCTCGCCGGTGAGTCGAACCGGGTGCGGACAAGCAGGCATGCATGCGGGTAAGTGAACAAGCAGGTACGTGAACAAGCAGGCTCGCGAACAAGTGAGCGGGCATGCCAGCTCGCTTGCTAGCTTGCGTGTCGACAAGCAGGTATACAAGCAGACAAGCTGGCGGGCAGGTATGTGGGTACGCGGACAAGCAGGCTCGCGAACAAGTACGCTTGCATGCCTGCGGGTGAACAAGTGAGCTTACAAGCCGGCTGGTAAGTACGCTTGTGCGCGGACAAGCTTGTGGGTACACAAGCATGCTTGCTCGTATGCATGCCGGCTTGTGGGTATGCTCGCGGGTATGTATAACCGAAGGTATACAAGGGAGCGGGTACGTACGCCGGCATGCTTGCTAGCAGACAAGCAGGTACGTGAGCCGGTATGTGAGTATACAAGTGTGCGGACAAGCCAGCGGGCAGGTACACAAGTGAGCCAGCGGACAAGCGCGTACGCGGGTAGGTGGGCGGGCTCGCATGCCGGCGGGTATACAAGCTTGCGCACAAGCTTGTGGGTACACAAGCGGGCTCGTGCGCCGGTACGCTTGCTCGCTGGCGGGCTCGTGAACAAGTGCGCCGGCACGTACGCAGGTGAGCGGACAAGCCGGCTCACAAGCCAGCAGGTACGCTGGCTTGCTCGTCGACAAGCAGGCTCGCGAACAAGCGCGCCGGCTCGCGAACAAGTGAGCCAGCGGACAAGCACGCAGGCTAGCAGGCTCGCATGCGGACAAGCGCGCTTGTACACAAGCAGACAAGCTGGTGGGCATGCCAACAAGCTAGCTTGCTCGCGTGCGGGTACACAAGCAGGCTCGCGAACAAGCACGCGGGTGAGTGAGCGGGTACACAAGCGCGTGGGTGAGTGGGTACGCGGACAAGCCGGCTCACAAGCATGCTTGCTGGTAAGTACGCTTGCTGGCCGGTATGCGGACAAGTGTGCCGGTGAGCCAACAAGTGAGCCAGCGGACAAGCATGTGGGTACGTACGCGGGCTCGTGAACAAGCCAGTGGGCTGGCAGGCTCACAAGCATGCCAGCAGGCTAGCTAGCGGGCTCGCGTGCGGGTAT

IMMERSIVE EXPERIENCES

The project explores also the possibility of being enjoyed in a digital experience to enhance with the audience. A complete digital graphic ecosystem has been created to achieve this goal.

Play Video

We are producing a complete documentary to expand the social reaching of the project and to explain all the details related with the Manifesto, from the technical point of view to the conceptual.

The documentary will include interviews, lab images and the shooting recorded in Svalbard.

56min

Play Video

Graphic production.

C-prints, serigraphy. Variable sizes.

In collaboration with Miguel Noya, Javier Forment and other guess artists we are making a very special music album with the DNA sonification.

The album has 16 tracks corresponding to each fragment of the manifesto.

We have subjected the fragments of the Manifesto Terricola to the artificial intelligence vision of Stable Difussion.

2023

IDAF, Estambul, Turkey
Espronceda Institute, Barcelona, Spain.
DART Festival, Barcelona. Spain.
UCAB, Caracas, Venezuela.
IN Material, Metahauss, Paris, France.
Kronus Festival. Barcelona, Spain.

Credits

Bioinformatics
Javier Forment

Biomaterial
Gwendolin Roote

Music album collaboration
Miguel Noya

Sound Earth Legacy

Development partners
IFT (Institute for Future Technologies), DVIC, Paris. France.

ESAT

SLStudio production